Mycobacterium ulcerans strain Agy99 and its 174-kb pMUM001 plasmid

I quote the passages from:

Giant plasmid-encoded polyketide synthases produce the macrolide toxin of Mycobacterium ulcerans

"...MU contains a 174-kb plasmid, pMUM001, bearing a cluster of genes encoding giant polyketide synthases (PKSs), and polyketide-modifying enzymes, and demonstrate that these are necessary and sufficient for mycolactone synthesis."

"...reflects the acquisition of pMUM001 by horizontal transfer."

"...The 12-membered core of mycolactone is produced by two giant, modular PKSs,
MLSA1 (1.8 MDa) and MLSA2 (0.26 MDa), whereas its side chain is synthesized by MLSB (1.2 MDa), a third modular PKS highly related to MLSA1."

"...There is an extreme level of sequence identity within the different domains of the MLS cluster (>97% amino acid identity), so much so that the 16 ketosynthase domains seem functionally identical."

"..confirming the existence in MU of a circular plasmid, designated pMUM001, comprising 174,155 bp, with a GC content of 62.8% and carrying 81 protein-coding DNA sequences."

"..Replication seems to be initiated by the predicted product of repA, which shares
68.3% amino acid identity with RepA from the cryptic Mycobacterium fortuitum plasmid, pJAZ38 (10)"

"..Two different direct repeat regions were identified 500–1,000 bp upstream of repA, suggesting possible replication origins (ori). GC-skew plots [(G - C) (G+ C)], which highlight compositional biases between leading and lagging DNA strands, displayed a random pattern and did not help pinpoint a possible ori (Fig. 2)."

"..Approximately 2 kb downstream of repA is parA, a gene encoding a chromosome partitioning protein, required for plasmid segregation on cell division. In this region, there is also a potential regulatory gene cluster composed of a serine threonine protein kinase (mup008), a gene encoding a protein of unknown function(mup018) but containing a phosphopeptide recognition domain,a domain found in many regulatory proteins (11), and a WhiB like transcriptional regulator (mup021)."

"...The plasmid is rich in insertion sequences (IS), with 26 examples, including
4 copies of IS2404 and 8 copies of IS2606 (13)."

Circular presentation of pMUM001:

 Here

 
My contribution for pMUM001 plasmid seen from a new perspective by Dot-plot analysis :


by virtual 2G gel:

PKS,polyketide synthase
KS, ketosynthase
TE, thioesterase

by UGENE

Mycobacterium ulcerans prophages

Most probably the idea to utilize Phage Therapy in human Buruli disease is impracticable at moment.

In the Net there is not any information about this but only one scientific work with mouse model.

In spite of everything I think it is useful to try all possibilities for exploring new forms of drugs in Buruli disease and among these also Phage therapy.

I quote the passages from :

Reductive evolution and niche adaptation inferred from the genome of Mycobacterium ulcerans, the causative agent of Buruli ulcer

".....771 pseudogenes, two bacteriophages, and multiple DNA deletions and rearrangements."

"The two prophages named phiMU01 (18 kb, 18 CDS) and phiMU02 (24 kb, 17 CDS) resemble other mycobacteriophages in overall structure, integrating near tRNA genes and containing CDS associated with replication functions. However, phiMU02 may be non-functional, as several of its genes have been inactivated by multiple IS2606 insertions."

"...and acquisition of foreign genes, often via plasmids or bacteriophage, that confer a fitness advantage in the new environment."

I want to check the passages quoted above because they are not described in details:

1° passage:

"The two prophages named phiMU01 (18 kb, 18 CDS) and phiMU02 (24 kb, 17 CDS) resemble other mycobacteriophages in overall structure, integrating near tRNA genes and containing CDS associated with replication functions."

In the beginning if these prophages were mycobacterium phages probably they have still some common features with other Mycobacterium phage genomes like D29,L5, BXZ2 and TM4.

2° passage:

"...phiMU02 may be non-functional, as several of its genes have been inactivated by multiple IS2606 insertions."


Checking by Gepard software

 phiMU01 versus phiMU01:
 
 

 phiMU02 versus phiMU02:


 
 explanation:



 By Mauve software and M-GCAT sofware the genomes are compared:

 phiMU01 versus phiMU02:

  alignment by JAligner

Now to shoot off :

a-For avoiding misunderstandings I have written the words by WIKIPEDIA:

Prophage:A prophage is a phage genome inserted as part of the linear structure of the DNA chromosome of a bacterium. A temperate phage integrated into the host chromosome or existing as an extrachromosomal plasmid. This is a latent form of a bacteriophage in which the viral genes are incorporated into the bacterial chromosomes without causing disruption of the bacterial cell.
Upon detection of host cell damage, the prophage is excised from the bacterial chromosome in a process called prophage induction. After induction, viral replication begins via the lytic cycle. Prophages are important agents of horizontal gene transfer, and are considered to be part of the mobilome.

Bacteriophage

b-phiMU01 and phiMU02 sequences are extracted from Mycobacterium ulcerans genome by Artemis software :

>misc_feature misc_feature Prophage phiMU01 523696:542119 forward
CCTTGCCGATAGACGGTACCGGCGCGCCCTGACGGGA
CGCGAACGATCAAGAAGCTACCCGCGCCGGTGTCGCT
GGACGGCACTCTAATAACGTCGCGGCTCGCTGGCGTT
GGAATTCAG..........AATC
>misc_feature misc_feature Prophage phiMU02 3582899:3606951 reverse
GTCAAGTGGTCGCAGGTTCAAATCCTGTCAGCCCGACCA
GAACGTTCTTACTCAAACCAGTGACCGAAAAGACACCGG
CCAAGGTGAGCGACTCCGTTCCGGTGGATCTAGGAGCC
CCTG......ACAT
c- each prophage genome is examined and compared with D29, L5,TM4 and BXZ2 genomes by Gepard software:


phiMU01 versus D29 phage :
 

 phiMU01, phiMU02 versus D29 phage:




The LCB weight sets the minimum number of matching nucleotides identified in a collinear region for that region to be considered true homology versus random similarity.

 phiMU01, phiMU02 versus Bxz2 phage:





 phiMU01, phiMU02 versus L5 phage:




 phiMU01, phiMU02 versus TM4 phage:



 all phages above:




Conclusions :
phiMU01 versus D29 phage



 all phages above:





This analysis reinforces my conviction about the presence in the soil , fresch water or in other sources of specific phages for Mycobacterium ulcerans. I am sure "nothing seek, nothing find".

phiMmar01

Why?

Mycobacterium ulcerans prophages



By Artemis :



By Mauve:


By Gepard :


phiMmar01/phiMmar01



phiMU01/phiMmar01




phiMU02/phiMmar01



MU and Mmar Prophages






Integrase Comparison

Going in search of phages for Mycobacterium ulcerans

This is my opinion about the question.

In practice at the moment I do not have the possibility to search phages for Mycobacterium ulcerans but, if I do not have real phages, however, I can study all potential phages (prophages) inside Mycobacterium marinum and Mycobacterium ulcerans genome.


1-If I find some correlations among "prophages" of these Mycobacteria I have further evidence that M. ulcerans is originated from M.marinum.

2-If I find some correlations between "prophages" of these Mycobacteria I have further evidence that specific phages for M. ulcerans and M.marinum could exist.



I quote the passage from:

Insights from the complete genome sequence of
Mycobacterium marinum on the evolution of Mycobacterium tuberculosis

"...and 10 putative prophages, named phiMmar01–10 (Supplemental Table 2)."




I will study these potential "prophages" one by one.

KEGG: Mycobacterium ulcerans

Mycobacterium ulcerans

Genome Genome info Genome map Pathway Pathway list Search pathway Color pathway Brite Brite list Search brite Color brite Module Module list Blast BLAST search FASTA search Taxonomy KEGG Organisms

Genome information T number T00435 Org code mul Aliases MYCUA, 362242 Full name Mycobacterium ulcerans Definition Mycobacterium ulcerans Agy99 Annotation manual Taxonomy TAX: 362242     Lineage Bacteria; Actinobacteria; Actinobacteridae;                                                                                  Actinomycetales;Corynebacterineae;                                                                                 Mycobacteriaceae; Mycobacterium Data source RefSeq (Assembly:GCA_000013925.1) Original DB Pasteur Keywords Human pathogen Disease H00285 Blau syndrome H01042 Buruli ulcer Comment Isolated from an ulcerative lesion on the right elbow                                                                    of a female patient from the Ga district of Ghana in 1999 Chromosome Circular     Sequence RS: NC_008611     Length 5631606 Plasmid pMUM001; Circular     Sequence RS: NC_005916     Length 174155 Statistics Number of nucleotides: 5805761 Number of protein genes: 4241 Number of RNA genes: 50 Reference PMID: 17210928     Authors Stinear TP, et al.     Title Reductive evolution and niche adaptation inferred from                                                               the genome of Mycobacterium ulcerans, the causative                                                         agent of Buruli ulcer.     Journal Genome Res 17:192-200 (2007)

Summary of Mycobacterium ulcerans, Strain Agy99

From: BioCyc Database Collection

Replicon	Total Genes	Protein Genes	RNA Genes	Pseudogenes	Size (bp)
Chromosome 1	4981	4931	50	771	5,631,606
Plasmid 1	81	81	0	0	174,155
Total:	5062	5012	50	771	5,805,761

Pathways:	193
Enzymatic Reactions:	1209
Transport Reactions:	53
Polypeptides:	4241
Protein Complexes:	11
Enzymes:	841
Transporters:	67
Compounds:	806
Transcription Units:	3542
tRNAs:	51

Mycobacterium ulcerans Agy99

        Browse Genome         BLAST Genome        
About Genome

• Overview
• Statistics
• Genes

Overview

Proposal Name	Mycobacterium ulcerans Agy99
Organism Name	Mycobacterium ulcerans Agy99
Taxon ID	642555140
NCBI Taxon ID	362242
GOLD ID in IMG Database	Project ID: Gc00469
External Links	; NCBI/RefSeq:NC_005916; NCBI/RefSeq:NC_008611; PUBMED:14736915; PUBMED:17210928
Lineage	Bacteria; Actinobacteria; Actinobacteria; Actinomycetales; Mycobacteriaceae; Mycobacterium; ulcerans
Sequencing Status	Finished
IMG Release	IMG/W 2.7
Comment
Release Date	2008-12-01
Add Date	2008-09-20
Modified Date	2011-08-16
Distance Matrix Calc. Date	2014-07-02
High Quality	Yes
Is Public	Yes
Project Information
Cultured	Yes
Culture Type	Isolate
Geographic Location	ulcerative lesion on the right elbow of a female patient from the Ga district of Ghana in 1999
GOLD ID	Gc00469
Isolation Country	Ghana
Isolation Year	July, 1999
NCBI Project ID	16230
Publication Journal	Genome Res. (17, 192-200)
GOLD Sequencing Status	Complete
Project Sequencing Method	Sanger
Sequencing Center	Institut Pasteur
Metadata
Assembly Method	Phrap, Gap4
Biotic Relationships	Free living
Cell Shape	Rod-shaped
Ecosystem	Host-associated
Ecosystem Category	Human
Ecosystem Type	Unclassified
Ecosystem Subtype	Unclassified
Gram Staining	Gram+
Host Name	Homo sapiens
Host Gender	Female
Host Health	Patient
Isolation	ulcerative lesion on the right elbow of a female patient from the Ga district of Ghana in 1999
Library Method	2-3Kb, 3-5Kb, 5-10Kb
Motility	Nonmotile
Oxygen Requirement	Aerobe
Specific Ecosystem	Unclassified
Sporulation	Nonsporulating
Temperature Range	Mesophile
Temperature Optimum	32
Sample Body Site	Skin
Relevance	Medical, Human Pathogen
Phenotype	Pathogen, Antibiotic resistant
Habitat	Host, Fresh water
Diseases	Buruli ulcer
Cell Arrangement	Singles
Energy Source	Chemoorganotroph
Phenotypes/Metabolism from Pathway Assertion
Metabolism	Auxotroph (L-lysine auxotroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (L-alanine prototroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (L-aspartate prototroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (L-glutamate prototroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Auxotroph (L-phenylalanine auxotroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Auxotroph (L-tyrosine auxotroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Auxotroph (L-tryptophan auxotroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Auxotroph (L-histidine auxotroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Auxotroph (Glycine prototroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (L-arginine prototroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (L-asparagine prototroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (L-cysteine prototroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (L-glutamine prototroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (L-isoleucine prototroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Auxotroph (L-leucine auxotroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (L-proline prototroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (L-serine prototroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (L-threonine prototroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (L-valine prototroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	(Non-selenocysteine synthesizer) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (Biotin prototroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (Coenzyme A prototroph) (IMG_PIPELINE; 2012-10-10)
Metabolism	(Glucose utilizing) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (L-methionine synthesis with homocysteine as intermediate) (IMG_PIPELINE; 2012-10-10)
Metabolism	Prototrophic (L-methionine synthesis with methanethiol) (IMG_PIPELINE; 2012-10-10)

Genome Statistics

To view rows that are zero, go to MyIMG preferences
and set "Hide Zeroes in Genome Statistics" to "No".

	Number	% of Total
DNA, total number of bases	5805761	100.00%
DNA coding number of bases	4236262	72.97%
DNA G+C number of bases	3796479	65.39% 1
DNA scaffolds	2	100.00%
Plasmid Count	1
Genes total number	4306	100.00%
Protein coding genes	4241	98.49%
RNA genes	65	1.51%
rRNA genes	3	0.07%
5S rRNA	1	0.02%
16S rRNA	1	0.02%
23S rRNA	1	0.02%
tRNA genes	45	1.05%
Other RNA genes	17	0.39%
Protein coding genes with function prediction	2792	64.84%
without function prediction	1449	33.65%
Protein coding genes connected to SwissProt Protein Product	340	7.90%
not connected to SwissProt Protein Product	3901	90.59%
Protein coding genes with enzymes	1007	23.39%
w/o enzymes but with candidate KO based enzymes	10	0.23%
Protein coding genes connected to Transporter Classification	293	6.80%
Protein coding genes connected to KEGG pathways3	1053	24.45%
not connected to KEGG pathways	3188	74.04%
Protein coding genes connected to KEGG Orthology (KO)	1735	40.29%
not connected to KEGG Orthology (KO)	2506	58.20%
Protein coding genes connected to MetaCyc pathways	988	22.94%
not connected to MetaCyc pathways	3253	75.55%
Protein coding genes with COGs3	2592	60.20%
with KOGs3	1546	35.90%
with Pfam3	3619	84.05%
with TIGRfam3	1074	24.94%
with InterPro	3572	82.95%
with IMG Terms	870	20.20%
with IMG Pathways	336	7.80%
with IMG Parts List	322	7.48%
in paralog clusters	2561	59.48%
in Chromosomal Cassette	4306	100.00%
Chromosomal Cassettes	673	-
Biosynthetic Clusters	69	-
Genes in Biosynthetic Clusters	980	22.76%
Fused Protein coding genes	352	8.17%
Protein coding genes coding signal peptides	298	6.92%
Protein coding genes coding transmembrane proteins	839	19.48%
COG clusters	1326	51.16%
KOG clusters	725	27.97%
Pfam clusters	1778	49.13%
TIGRfam clusters	881	82.03%

Notes:
1 - GC percentage shown as count of G's and C's divided by the total number of bases.
      The total number of bases is not necessarily synonymous with a total number of G's, C's, A's, and T's. 2 - Pseudogenes may also be counted as protein coding or RNA genes, so is not additive under total gene count. 3 - Graphical view available.

Browse Genome

Phylogenetic Distribution of Genes

Putative Horizontally Transferred Genes

Compare Gene Annotations

Compare Gene Annotations

Gene annotation values are precomputed and stored in a tab delimited file
also viewable in Excel.

Scaffold Consistency Check

Kmer Frequency Analysis

Export Gene Information

Export Gene Information

Gene information is precomputed and stored in a tab delimited file
also viewable in Excel.

Export Genome Data

Scaffold Search

Scaffold search allows for seaching for all scaffolds within an organism or microbiome.
Please enter a search term or matching substring for scaffold name or read ID.

or enter low and high range for
-